Angela Bitting retweeted
Today feels like a good day to share some DNA haikus…
🌾 Twist, snip, paste, repeat,
DNA’s our crafty cheat—
Who needs Mendel’s wheat?
Angela Bitting retweeted
⚡️DNA up to 5 kb! Just a reminder that you can get Twist Express Genes, sequence perfect Clonal Genes shipped in as few as 5 days,* in the vector of your choice.
Get your genes here: twistbioscience.com/products…
Or gene fragments shipped in as few as 2 days: twistbioscience.com/products…
Angela Bitting retweeted
🚇 Spotted in Boston: our ads, now live on the subway, making rush hour slightly less painful!
🧬 WE love science, we love scientists 🧬
You've seen us on the subway, now see what we're all about:
bit.ly/4h5kGCC
Angela Bitting retweeted
🚐 Beep, beep! @TwistBioscience is bringing science on the road to you! We will be criss-crossing the nation, rolling up in our Twist Sprinter Van to share some food, world famous #TwistSwag, prizes, and to hear about the science that you’re passionate about…
Really great to be able to give back to the community, serving with my amazing colleagues
🫶 Twist SSF & Alameda County Community Food Bank teamed up to bring over 21,000 meals to local residents in need. Twisters helped sort and pack fresh produce in support of @ACCFB’s mission to eradicate hunger and provide nutritious food to those in need across Alameda County.
Angela Bitting retweeted
🥇🥈🥉The Olympics as things seen in science…
First up: Sailing as the PI and et. al.
Angela Bitting retweeted
AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA
Angela Bitting retweeted
Back by popular demand for 2024: The #Oscars as things seen in science.
First up, Sam Rockwell as a failed PCR
So proud of @TwistBioscience @EmilyLeproust ! Fabulous night with so many special touches @CALifeSciences
About last night…
Huge congratulations to our CEO and co-founder @EmilyLeproust for winning @CaLifeSciences’ 2023 Pantheon Award for Leadership. We couldn’t agree more! 🧬
Angela Bitting retweeted
#VMAs as things seen around the lab…
First up: Justina Valentine as slime mold
Angela Bitting retweeted
It’s here! Our 2023 ESG report is now live. Find out how our miniaturized platform for writing DNA is different than traditional 96-well plate approaches in terms of carbon emissions- we've quantified it…investors.twistbioscience.co…
I’m really proud to work at a company that is committed to not only implementing, but consistently advancing ESG practices. Shout out to @TwistBioscience for taking the next step by joining the @globalcompact! Read more on the #TwistBlog… twistbioscience.com/blog/com…
The covid pandemic has made a great case for viral discovery and monitoring. @TwistBioscience understands the importance of virus management and has developed #NGS and synthetic control tools to support researchers. Great read about them here… asianscientist.com/2023/01/s…
What a year!
This Year’s Top Moments In #Biotech! 2022’s most exciting advances involving #syntheticbiology and how they forecast a rising tide of scientific progress in 2023. #synbio #TwistBlog
twistbioscience.com/blog/sci…
Data storage demand will outstrip capacity in the near future. I’m excited by the #DNADataStorage work that @TwistBioscience is doing to help bridge this gap! #DNA @techradar #datastorage techradar.com/news/forget-hd…
If you’re new to DNA data storage, or a fan wanting to know the latest, check out this short video with Twist CEO @EmilyLeproust. Proud the be #WritingTheFuture of data storage with @TwistBioscience #DNA 🧬 voanews.com/a/dna-molecules-…
Ha! @TwistBioscience social media team is having some fun today! 🧬 #AprilFoolsDay xitter.cf/twistbioscience/status…